| Basic information from miRBase |
| hairpin accession number: MI0004782 |
| Located between position 23602850 and 23602929 on chromosome 2 strand + |
| Overlapping with sense strand of vmhc-001 (intron 29). |
| (Ensemble: OTTDART00000024215) |
| mature miRNAs for MI0004782: |
| dre-miR-736 (MIMAT0003767): GTAAGACGAACAAAAAGTTTT |
| You can find this miRNA in ENTREZGENE: mir736 (accession: 100033749) |
| References |
| [1]Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH, Nucleic Acids Res. 34:2558-2569(2006)., "Cloning and expression of new microRNAs from zebrafish" |