| Basic information from miRBase |
| hairpin accession number: MI0015577 |
| Located between position 466718 and 466767 on chromosome scaffold_89 strand + |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSCINT00000002182) |
| mature miRNAs for MI0015577: |
| cin-miR-4026-5p (MIMAT0016542): GTAAGTGATGACGTCATTTG |
| cin-miR-4026-3p (MIMAT0016543): TCTATGACGTCATTACTACG |
| You can find this miRNA in ENTREZGENE: mir4026 (accession: 100499106) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |