| Basic information from miRBase |
| hairpin accession number: MI0009946 |
| Located between position 115464461 and 115464549 on chromosome 2 strand + |
| Overlapping with sense strand of RP23-297K24.1-002 (intron 3). |
| (Ensemble: OTTMUST00000036062) |
| mature miRNAs for MI0009946: |
| mmu-miR-1951 (MIMAT0009422): GTAGTGGAGACTGGTGTGGCTA |
| You can find this miRNA in MGI: Mir1951 (accession: 3837029) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |