| Basic information from miRBase |
| hairpin accession number: MI0010844 |
| Located between position 55426098 and 55426202 on chromosome 16 strand + |
| Overlapping with sense strand of col27a1a-201 (intron 8). |
| (Ensemble: ENSDART00000057304) |
| mature miRNAs for MI0010844: |
| dre-miR-455b (MIMAT0011302): GTATGTGCCCTTGGACTACATT |
| You can find this miRNA in ENTREZGENE: mir455b (accession: 100310771) |
| References |
| [1]Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA, BMC Genomics. 10:195(2009)., "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" |