| Basic information from miRBase |
| hairpin accession number: MI0015576 |
| Located between position 2209039 and 2209095 on chromosome 9p strand - |
| mature miRNAs for MI0015576: |
| cin-miR-4025-5p (MIMAT0016541): GTATGTGTTTGGTGAAAAGA |
| You can find this miRNA in ENTREZGENE: mir4025 (accession: 100498910) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |