Basic information from miRBase |
hairpin accession number: MI0015576 |
Located between position 2209039 and 2209095 on chromosome 9p strand - |
mature miRNAs for MI0015576: |
cin-miR-4025-5p (MIMAT0016541): GTATGTGTTTGGTGAAAAGA |
You can find this miRNA in ENTREZGENE: mir4025 (accession: 100498910) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" ![]() |