Basic information from miRBase |
hairpin accession number: MI0015534 |
Located between position 5410360 and 5410408 on chromosome 7q strand - |
Overlapping with antisense strand of (intron 21). |
(Ensemble: ENSCINT00000015751) |
mature miRNAs for MI0015534: |
cin-miR-4006a-5p (MIMAT0016478): TGGAACATGTAAGTAAGGGC |
cin-miR-4006a-1-3p (MIMAT0016479): GTCATTATTTTCATGCTTCA |
You can find this miRNA in ENTREZGENE: mir4006a-1 (accession: 100499098) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |