| Basic information from miRBase |
| hairpin accession number: MI0008785 |
| Located between position 2369338 and 2369431 on chromosome 16 strand - |
| Overlapping with sense strand of XM_001173008.1 (intron 1). |
| (Ensemble: ENSPTRT00000014100) |
| mature miRNAs for MI0008785: |
| ptr-miR-572 (MIMAT0008248): GTCCGCTCGGCGGTGGCCCA |
| You can find this miRNA in ENTREZGENE: MIR572 (accession: 100316490) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |