| Basic information from miRBase |
| hairpin accession number: MI0015499 |
| Located between position 5400845 and 5400896 on chromosome 7q strand - |
| Overlapping with antisense strand of (intron 20). |
| (Ensemble: ENSCINT00000015751) |
| mature miRNAs for MI0015499: |
| cin-miR-4000d-5p (MIMAT0016428): TGAAACTTGCAAGAACGGGC |
| cin-miR-4000d-3p (MIMAT0016429): GTCCTTTCCAACAGGTTTC |
| You can find this miRNA in ENTREZGENE: mir4000d (accession: 100498871) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |