miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0007833
Located between position 198089312 and 198089409 on chromosome 1 strand +
mature miRNAs for MI0007833:
         mml-miR-557 (MIMAT0006426): GTCTGCATGGGTGAGCCTTATCT
You can find this miRNA in ENTREZGENE: MIR557 (accession: 100315550)

References
[1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome"