Basic information from miRBase |
hairpin accession number: MI0007833 |
Located between position 198089312 and 198089409 on chromosome 1 strand + |
mature miRNAs for MI0007833: |
mml-miR-557 (MIMAT0006426): GTCTGCATGGGTGAGCCTTATCT |
You can find this miRNA in ENTREZGENE: MIR557 (accession: 100315550) |
References |
[1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |