| Basic information from miRBase |
| hairpin accession number: MI0008575 |
| Located between position 104615240 and 104615348 on chromosome 14 strand + |
| mature miRNAs for MI0008575: |
| ptr-miR-203 (MIMAT0008065): GTGAAATGTTTAGGACCACTAG |
| You can find this miRNA in ENTREZGENE: MIR203 (accession: 100316118) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |