| Basic information from miRBase |
| hairpin accession number: MI0008823 |
| Located between position 39239129 and 39239224 on chromosome 15 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000012851) |
| mature miRNAs for MI0008823: |
| ptr-miR-627 (MIMAT0008286): GTGAGTCTCTAAGAAAAGAGGA |
| You can find this miRNA in ENTREZGENE: MIR627 (accession: 100316497) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |