| Basic information from miRBase |
| hairpin accession number: MI0015530 |
| Located between position 7635858 and 7635909 on chromosome 1q strand - |
| Overlapping with antisense strand of (3UTR 1). |
| (Ensemble: ENSCINT00000002686) |
| mature miRNAs for MI0015530: |
| cin-miR-4004-5p (MIMAT0016471): GTGAGTTTGTTGTATTGTGGT |
| You can find this miRNA in ENTREZGENE: mir4004 (accession: 100499146) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |