| Basic information from miRBase |
| hairpin accession number: MI0012782 |
| Located between position 60069240 and 60069295 on chromosome 11 strand + |
| Overlapping with sense strand of LOC100052283 (intron 15). |
| (Ensemble: ENSECAT00000021750) |
| mature miRNAs for MI0012782: |
| eca-miR-33b (MIMAT0013037): GTGCATTGCTGTTGCATTGC |
| You can find this miRNA in ENTREZGENE: MIR33B (accession: 100314847) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |