| Basic information from miRBase |
| hairpin accession number: MI0008627 |
| Located between position 38432670 and 38432764 on chromosome 17 strand + |
| Overlapping with sense strand of (intron 9). |
| (Ensemble: ENSPTRT00000065176) |
| mature miRNAs for MI0008627: |
| ptr-miR-33b (MIMAT0008108): GTGCATTGCTGTTGCATTGC |
| You can find this miRNA in ENTREZGENE: MIR33B (accession: 100316145) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |