| Basic information from miRBase |
| hairpin accession number: MI0009807 |
| Located between position 120037611 and 120037679 on chromosome 5 strand + |
| Overlapping with sense strand of SREBF2 (intron 15). |
| (Ensemble: ENSBTAT00000018956) |
| mature miRNAs for MI0009807: |
| bta-miR-33a (MIMAT0009294): GTGCATTGTAGTTGCATTGCA |
| You can find this miRNA in ENTREZGENE: MIR33A (accession: 100313374) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |
| [2]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species" |