miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008424
Located between position 158822505 and 158822586 on chromosome 6 strand +
mature miRNAs for MI0008424:
         ptr-miR-1202 (MIMAT0007956): GTGCCAGCTGCAGTGGGGGAG
You can find this miRNA in ENTREZGENE: MIR1202 (accession: 100316410)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"