| Basic information from miRBase |
| hairpin accession number: MI0008424 |
| Located between position 158822505 and 158822586 on chromosome 6 strand + |
| mature miRNAs for MI0008424: |
| ptr-miR-1202 (MIMAT0007956): GTGCCAGCTGCAGTGGGGGAG |
| You can find this miRNA in ENTREZGENE: MIR1202 (accession: 100316410) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |