| Basic information from miRBase |
| hairpin accession number: MI0011539 |
| Located between position 27012633 and 27012704 on chromosome 9 strand + |
| Overlapping with sense strand of HDDC2_BOVIN (intron 5). |
| (Ensemble: ENSBTAT00000004334) |
| mature miRNAs for MI0011539: |
| bta-miR-2477 (MIMAT0012069): GTGGAATGATGATAAGTCTGACG |
| You can find this miRNA in ENTREZGENE: MIR2477 (accession: 100313302) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |