| Basic information from miRBase |
| hairpin accession number: MI0017335 |
| Located between position 54625181 and 54625260 on chromosome 12 strand - |
| Overlapping with sense strand of CBX5-202 (3UTR 5). |
| (Ensemble: ENST00000439541) |
| mature miRNAs for MI0017335: |
| hsa-miR-3198 (MIMAT0015083): GTGGAGTCCTGGGGAATGGAGA |
| References |
| [1]Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK, PLoS One. 5:e9685(2010)., "Characterization of the Melanoma miRNAome by Deep Sequencing" |
| [2]Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C, Cancer Res. 71:78-86(2011)., "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" |