| Basic information from miRBase |
| hairpin accession number: MI0011339 |
| Located between position 77505318 and 77505396 on chromosome 15 strand + |
| Overlapping with sense strand of MADD (intron 14). |
| (Ensemble: ENSBTAT00000028927) |
| mature miRNAs for MI0011339: |
| bta-miR-2318 (MIMAT0011841): GTGTATGATGAATTATCTGACC |
| You can find this miRNA in ENTREZGENE: MIR2318 (accession: 100313138) |
| References |
| [1]Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ, PLoS One. 4:e6349(2009)., "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" |