| PROMOTER INFORMATION | ||||||||||||||
| 127 | chr10, 17891267-17891467, + | promoter sequence | Marson et al. |  | | |||||||||
| 876 | chr10, 17922113-17927199, + | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |
| Basic information from miRBase |
| hairpin accession number: MI0003127 |
| Located between position 17887107 and 17887193 on chromosome 10 strand + |
| Overlapping with sense strand of MRC1L1-001 (intron 5). |
| (Ensemble: OTTHUMT00000047054) |
| mature miRNAs for MI0003127: |
| hsa-miR-511 (MIMAT0002808): GTGTCTTTTGCTCTGCAGTCA |
| You can find this miRNA in HGNC: MIR511-1 (accession: 32077) |
| References | ||||||||||||||
| [1]Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z, Nat Genet. 37:766-770(2005)., "Identification of hundreds of conserved and nonconserved human microRNAs" | ||||||||||||||
| PROMOTER INFORMATION | ||||||||||||||
| 127 | chr10, 17891267-17891467, + | promoter sequence | Marson et al. | | | |||||||||
| 876 | chr10, 17922113-17927199, + | promoter sequence | UCSC | | | |||||||||
| more data |
| Expression data from dbDEMC |
| Expression data from PhenomiR |