miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0005847

Located between position 8046377 and 8046475 on chromosome 2R strand -

Overlapping with sense strand of Prp8-RA (intron 9).

(Ensemble: FBtr0088016) (FlyBase: FlyBase)

mature miRNAs for MI0005847:

dme-miR-988-5p (MIMAT0020886): GTGTGATTTGTAGCAAAGTGAT

dme-miR-988-3p (MIMAT0005505): CCCCTTGTTGCAAACCTCACGC

References

[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"

[2]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"

[3]Kawamura Y, Saito K, Kin T, Ono Y, Asai K, Sunohara T, Okada TN, Siomi MC, Siomi H, Nature. 453:793-797(2008)., "Drosophila endogenous small RNAs bind to Argonaute 2 in somatic cells"

more data

Data from CoGemiR