| Basic information from miRBase |
| hairpin accession number: MI0008546 |
| Located between position 42610517 and 42610595 on chromosome 15 strand + |
| Overlapping with sense strand of XM_001163654.1 (exon 5). |
| (Ensemble: ENSPTRT00000012987) |
| mature miRNAs for MI0008546: |
| ptr-miR-147b (MIMAT0008040): GTGTGCGGAAATGCTTCTGCTA |
| You can find this miRNA in ENTREZGENE: MIR147B (accession: 100316445) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |