| Basic information from miRBase |
| hairpin accession number: MI0015571 |
| Located between position 39348 and 39411 on chromosome scaffold_197 strand - |
| Overlapping with sense strand of (intron 9). |
| (Ensemble: ENSCINT00000029050) |
| mature miRNAs for MI0015571: |
| cin-miR-4020b-5p (MIMAT0016533): GTGTGGTTGGTTGGTGGTTG |
| cin-miR-4020b-3p (MIMAT0016534): ACCCATTCATTCCCCGCACA |
| You can find this miRNA in ENTREZGENE: mir4020b (accession: 100498908) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |