| Basic information from miRBase |
| hairpin accession number: MI0008323 |
| Located between position 110694017 and 110694096 on chromosome 13 strand + |
| Overlapping with sense strand of Pde4d-012 (intron 2). |
| (Ensemble: OTTMUST00000080776) |
| mature miRNAs for MI0008323: |
| mmu-miR-1904 (MIMAT0007874): GTTCTGCTCCTCTGGAGGGAGG |
| You can find this miRNA in MGI: Mir1904 (accession: 3811419) |
| References |
| [1]He S, Su H, Liu C, Skogerbo G, He H, He D, Zhu X, Liu T, Zhao Y, Chen R, BMC Genomics. 9:236(2008)., "MicroRNA-encoding long non-coding RNAs" |