Basic information from miRBase |
hairpin accession number: MI0008805 |
Located between position 98489068 and 98489161 on chromosome 8 strand - |
Overlapping with antisense strand of XM_001151183.1 (intron 30). |
(Ensemble: ENSPTRT00000037860) |
mature miRNAs for MI0008805: |
ptr-miR-599 (MIMAT0008268): GTTGTGTCAGTTTATCAAAC |
You can find this miRNA in ENTREZGENE: MIR599 (accession: 100316241) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |