miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008805
Located between position 98489068 and 98489161 on chromosome 8 strand -
Overlapping with antisense strand of XM_001151183.1 (intron 30).
(Ensemble: ENSPTRT00000037860)
mature miRNAs for MI0008805:
         ptr-miR-599 (MIMAT0008268): GTTGTGTCAGTTTATCAAAC
You can find this miRNA in ENTREZGENE: MIR599 (accession: 100316241)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"