| Basic information from miRBase |
| hairpin accession number: MI0018004 |
| Located between position 79741906 and 79741975 on chromosome 4 strand + |
| Overlapping with sense strand of BMP2K-001 (intron 1). |
| (Ensemble: OTTHUMT00000362865) |
| mature miRNAs for MI0018004: |
| hsa-miR-5096 (MIMAT0020603): GTTTCACCATGTTGGTCAGGC |
| References |
| [1]Reshmi G, Chandra SS, Babu VJ, Babu PS, Santhi WS, Ramachandran S, Lakshmi S, Nair AS, Pillai MR, Genomics. [Epub prior to print](2011)., "Identification and analysis of novel microRNAs from Fragile Sites of Human Cervical Cancer: Computational and Experimental Approach" |