| Basic information from miRBase |
| hairpin accession number: MI0008775 |
| Located between position 147744457 and 147744553 on chromosome 1 strand + |
| mature miRNAs for MI0008775: |
| ptr-miR-557 (MIMAT0008238): GTTTGCACGGGTGGGCCTTGTCT |
| You can find this miRNA in ENTREZGENE: MIR557 (accession: 100316224) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |