miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0015760
Located between position 5581142 and 5581203 on chromosome 1q strand -
mature miRNAs for MI0015760:
         cin-miR-4203-3p (MIMAT0016823): TAAACAATGCTTGGATCTTGG
You can find this miRNA in ENTREZGENE: mir4203 (accession: 100499007)

References
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data"