Basic information from miRBase |
hairpin accession number: MI0015760 |
Located between position 5581142 and 5581203 on chromosome 1q strand - |
mature miRNAs for MI0015760: |
cin-miR-4203-3p (MIMAT0016823): TAAACAATGCTTGGATCTTGG |
You can find this miRNA in ENTREZGENE: mir4203 (accession: 100499007) |
References |
[1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |