miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008477
Located between position 83417156 and 83417237 on chromosome 15 strand -
Overlapping with sense strand of XM_510571.2 (intron 1).
(Ensemble: ENSPTRT00000013668)
mature miRNAs for MI0008477:
         ptr-miR-1276 (MIMAT0007997): TAAAGAGCCCTGTGGAGACA
You can find this miRNA in ENTREZGENE: MIR1276 (accession: 100316074)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"