| Basic information from miRBase |
| hairpin accession number: MI0008777 |
| Located between position 48514734 and 48514828 on chromosome 2a strand + |
| Overlapping with sense strand of (intron 6). |
| (Ensemble: ENSPTRT00000063895) |
| mature miRNAs for MI0008777: |
| ptr-miR-559 (MIMAT0008240): TAAAGTAAATATGCACCAAAA |
| You can find this miRNA in ENTREZGENE: MIR559 (accession: 100316226) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |