| Basic information from miRBase |
| hairpin accession number: MI0003073 |
| Located between position 47373151 and 47373232 on chromosome 3 strand - |
| Overlapping with sense strand of (intron 8). |
| (Ensemble: ENSMMUT00000018865) |
| mature miRNAs for MI0003073: |
| mml-miR-106b (MIMAT0002772): TAAAGTGCTGACAGTGCAGAT |
| You can find this miRNA in EMBL: AY866339 (accession: AY866339) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |