| Basic information from miRBase |
| hairpin accession number: MI0003070 |
| Located between position 99947103 and 99947184 on chromosome 7 strand - |
| Overlapping with sense strand of (intron 14). |
| (Ensemble: ENSPTRT00000036049) |
| mature miRNAs for MI0003070: |
| ptr-miR-106b (MIMAT0002769): TAAAGTGCTGACAGTGCAGAT |
| You can find this miRNA in EMBL: AY866338 (accession: AY866338) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |