Basic information from miRBase |
hairpin accession number: MI0002998 |
Located between position 92019234 and 92019304 on chromosome 13 strand + |
Overlapping with sense strand of (exon 3). |
(Ensemble: ENSPTRT00000054347) |
mature miRNAs for MI0002998: |
ptr-miR-20a (MIMAT0002697): TAAAGTGCTTATAGTGCAGGTA |
You can find this miRNA in EMBL: AY866314 (accession: AY866314) |
References |
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |