Basic information from miRBase |
hairpin accession number: MI0000385 |
Located between position 13613922 and 13614020 on chromosome 3L strand + |
Overlapping with antisense strand of bru-3-RA (intron 4). |
(Ensemble: FBtr0075815) (FlyBase: FlyBase) |
mature miRNAs for MI0000385: |
dme-miR-289-5p (MIMAT0000364): TAAATATTTAAGTGGAGCCTGCGACT |
You can find this miRNA in TARGETS:MIRTE: miR-289 (accession: miR-289) |
References |
[1]Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes" ![]() |
more data |
Data from CoGemiR |