| Basic information from miRBase |
| hairpin accession number: MI0008808 |
| Located between position 50099525 and 50099606 on chromosome 10 strand + |
| Overlapping with sense strand of XM_001162691.1 (intron 2). |
| (Ensemble: ENSPTRT00000004693) |
| mature miRNAs for MI0008808: |
| ptr-miR-605 (MIMAT0008271): TAAATCCCATGGTGCCTTCTCCT |
| You can find this miRNA in ENTREZGENE: MIR605 (accession: 100316351) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |