Basic information from miRBase |
hairpin accession number: MI0008541 |
Located between position 7199919 and 7200012 on chromosome 12 strand + |
mature miRNAs for MI0008541: |
ptr-miR-141 (MIMAT0008036): TAACACTGTCTGGTAAAGATGG |
You can find this miRNA in ENTREZGENE: MIR141-1 (accession: 100316374) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |