miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008541
Located between position 7199919 and 7200012 on chromosome 12 strand +
mature miRNAs for MI0008541:
         ptr-miR-141 (MIMAT0008036): TAACACTGTCTGGTAAAGATGG
You can find this miRNA in ENTREZGENE: MIR141-1 (accession: 100316374)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"