| Basic information from miRBase |
| hairpin accession number: MI0008542 |
| Located between position 7200978 and 7201071 on chromosome 12 strand + |
| mature miRNAs for MI0008542: |
| ptr-miR-141 (MIMAT0008036): TAACACTGTCTGGTAAAGATGG |
| You can find this miRNA in ENTREZGENE: MIR141-2 (accession: 100316101) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |