| Basic information from miRBase |
| hairpin accession number: MI0007663 |
| Located between position 4240772 and 4240861 on chromosome 1 strand + |
| mature miRNAs for MI0007663: |
| mml-miR-200a (MIMAT0006233): TAACACTGTCTGGTAACGATGT |
| You can find this miRNA in ENTREZGENE: MIR200A (accession: 100315399) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |