| Basic information from miRBase |
| hairpin accession number: MI0008573 |
| Located between position 1089402 and 1089490 on chromosome 1 strand + |
| mature miRNAs for MI0008573: |
| ptr-miR-200a (MIMAT0008063): TAACACTGTCTGGTAACGATGT |
| You can find this miRNA in ENTREZGENE: MIR200A (accession: 100316540) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |