miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013759
Located between position 5894308 and 5894400 on chromosome 21 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSTGUT00000018362)
mature miRNAs for MI0013759:
         tgu-miR-200a* (MIMAT0014640): CATCTTACTAGACAGTGCTGG
         tgu-miR-200a (MIMAT0014545): TAACACTGTCTGGTAACGATGTT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"