| Basic information from miRBase |
| hairpin accession number: MI0007620 |
| Located between position 1845434 and 1845534 on chromosome 16 strand - |
| mature miRNAs for MI0007620: |
| mml-miR-132 (MIMAT0006188): TAACAGTCTACAGCCATGGTCG |
| You can find this miRNA in ENTREZGENE: MIR132 (accession: 100315447) |
| References |
| [1]Yue J, Sheng Y, Orwig KE, BMC Genomics. 9:8(2008)., "Identification of novel homologous microRNA genes in the rhesus macaque genome" |