| Basic information from miRBase |
| hairpin accession number: MI0002028 |
| Located between position 26935251 and 26935352 on chromosome 8 strand + |
| mature miRNAs for MI0002028: |
| dre-miR-462 (MIMAT0001855): TAACGGAACCCATAATGCAGCT |
| You can find this miRNA in ENTREZGENE: mir462 (accession: 100033683) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |