| Basic information from miRBase |
| hairpin accession number: MI0009925 |
| Located between position 103923138 and 103923230 on chromosome 12 strand - |
| Overlapping with sense strand of Itpk1-201 (intron 1). |
| (Ensemble: ENSMUST00000046518) |
| mature miRNAs for MI0009925: |
| mmu-miR-1936 (MIMAT0009400): TAACTGACCTGCTGTGAACTGGC |
| You can find this miRNA in MGI: Mir1936 (accession: 3836973) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |