miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0009726

Located between position 55037785 and 55037871 on chromosome 13 strand -

Overlapping with antisense strand of (intron 5).

(Ensemble: ENSBTAT00000060959)

mature miRNAs for MI0009726:

bta-miR-124b (MIMAT0013774): TAAGGCACGCGGTGAATGCCAAG

You can find this miRNA in ENTREZGENE: MIR124B (accession: 100313252)

References

[1]Strozzi F, Mazza R, Malinverni R, Williams JL, Anim Genet. 40:125(2009)., "Annotation of 390 bovine miRNA genes by sequence similarity with other species"

[2]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"

[3]Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M, Mol Reprod Dev. 76:665-677(2009)., "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"