| Basic information from miRBase |
| hairpin accession number: MI0002996 |
| Located between position 92018920 and 92018990 on chromosome 13 strand + |
| Overlapping with sense strand of (exon 3). |
| (Ensemble: ENSPTRT00000054347) |
| mature miRNAs for MI0002996: |
| ptr-miR-18a (MIMAT0002695): TAAGGTGCATCTAGTGCAGATA |
| You can find this miRNA in EMBL: AY866314 (accession: AY866314) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |