Basic information from miRBase |
hairpin accession number: MI0008562 |
Located between position 133631309 and 133631378 on chromosome X strand - |
mature miRNAs for MI0008562: |
ptr-miR-18b (MIMAT0008054): TAAGGTGCATCTAGTGCAGTTAG |
You can find this miRNA in ENTREZGENE: MIR18B (accession: 100316322) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |