miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008562
Located between position 133631309 and 133631378 on chromosome X strand -
mature miRNAs for MI0008562:
         ptr-miR-18b (MIMAT0008054): TAAGGTGCATCTAGTGCAGTTAG
You can find this miRNA in ENTREZGENE: MIR18B (accession: 100316322)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"