Basic information from miRBase |
hairpin accession number: MI0005825 |
Located between position 13747748 and 13747839 on chromosome 2L strand - |
mature miRNAs for MI0005825: |
dme-miR-968-5p (MIMAT0005484): TAAGTAGTATCCATTAAAGGGTTG |
dme-miR-968-3p (MIMAT0020865): ACCTTTTGATGTACTACTTTAA |
References |
[1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
[2]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" |
more data |
Data from CoGemiR |