| Basic information from miRBase |
| hairpin accession number: MI0008600 |
| Located between position 116124027 and 116124098 on chromosome 4 strand - |
| Overlapping with antisense strand of XM_001144180.1 (intron 8). |
| (Ensemble: ENSPTRT00000030467) |
| mature miRNAs for MI0008600: |
| ptr-miR-302b (MIMAT0008087): TAAGTGCTTCCATGTTTTAGTAG |
| You can find this miRNA in ENTREZGENE: MIR302B (accession: 100316379) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |