| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005371 |
| Located between position 66075008 and 66075078 on chromosome 5 strand - |
| Overlapping with antisense strand of XM_001362168.1 (intron 8). |
| (Ensemble: ENSMODT00000007165) |
| mature miRNAs for MI0005371: |
| mdo-miR-302b (MIMAT0004180): TAAGTGCTTCCATGTTTTGG |
| You can find this miRNA in ENTREZGENE: Mir302b (accession: 100034307) |
| References |
| [1]Devor EJ, Samollow PB, J Hered. 99:66-72(2008)., "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" |
| more data |
| Data from CoGemiR |