| Basic information from miRBase |
| hairpin accession number: MI0008599 |
| Located between position 116123715 and 116123782 on chromosome 4 strand - |
| Overlapping with antisense strand of XM_001144180.1 (intron 8). |
| (Ensemble: ENSPTRT00000030467) |
| mature miRNAs for MI0008599: |
| ptr-miR-302a (MIMAT0008086): TAAGTGCTTCCATGTTTTGGTGA |
| You can find this miRNA in ENTREZGENE: MIR302A (accession: 100316131) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |